Stem-loop sequence gma-MIR172b

AccessionMI0001781 (change log)
DescriptionGlycine max miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

28 open access papers mention gma-MIR172b
(128 sentences)

Stem-loop
   uugac       guuu  g                     a    -    -u  -a       g  a uau  u   au 
5'      agucguu    gc gauguagcaucaucaagauuc caug caaa  ga  ggugggu gg c   ga gca  c
        |||||||    || ||||||||||||||||||||| |||| ||||  ||  ||||||| || |   || |||  c
3'      ucggcaa    cg cuacgucguaguaguucuaag gugu guuu  cu  cuaccua cc g   cu cgu  a
   -aauu       auac  a                     a    a    uu  gg       a  - --u  -   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 41847312-41847464 [-]
intergenic
Database links

Mature sequence gma-miR172b-5p

Accession MIMAT0020921
Sequence

23 - 

guagcaucaucaagauucac

 - 42

Get sequence
Evidence experimental; Illumina [3]

Mature sequence gma-miR172b-3p

Accession MIMAT0001683
Previous IDsgma-miR172b
Sequence

114 - 

agaaucuugaugaugcugcau

 - 134

Get sequence
Evidence experimental; 454 [1], Northern [1], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).