Stem-loop sequence gma-MIR172a

AccessionMI0001780 (change log)
DescriptionGlycine max miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

28 open access papers mention gma-MIR172a
(167 sentences)

Stem-loop
   uuaac       auuu  g                     a  -- g    -c  ag     --  g   g  uugau   au 
5'      agucguu    gc gauguagcaucaucaagauuc ca  u caag  gc  guggu  gg ugg ac     gca  c
        |||||||    || ||||||||||||||||||||| ||  | ||||  ||  |||||  || ||| ||     |||  u
3'      ucagcaa    cg cuacgucguaguaguucuaag gu  a guuu  ug  uaccg  cc acc ug     cgu  a
   -cacu       auac  a                     a  ca g    uc  ga     aa  g   g  ----u   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 6139598-6139756 [-]
intergenic
Database links

Mature sequence gma-miR172a

Accession MIMAT0001682
Sequence

120 - 

agaaucuugaugaugcugcau

 - 140

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).