Stem-loop sequence gma-MIR167a

AccessionMI0001777 (change log)
DescriptionGlycine max miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167a
(217 sentences)

Stem-loop
   gaa    g   --     aa     a    - -            ccuuu      aga   c 
5'    guuc caa  aggaa  aguga gcug c cagcaugaucua     gguuag   gcu a
      |||| |||  |||||  ||||| |||| | ||||||||||||     ||||||   |||  
3'    cagg guu  uccuu  ucacu cgac g gucguacuggau     ccaauc   uga a
   ---    g   ua     cc     c    a u            caguc      --g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 42073549-42073667 [+]
intergenic
Database links

Mature sequence gma-miR167a

Accession MIMAT0001679
Sequence

21 - 

ugaagcugccagcaugaucua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).