Stem-loop sequence gma-MIR166b

AccessionMI0001776 (change log)
DescriptionGlycine max miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

37 open access papers mention gma-MIR166b
(217 sentences)

Stem-loop
   gcuu        ga   u a a      uu      cu     -    --ggaggagg      a    aguacugagaucagug 
5'     gcaaaggu  ggu g g ggaaug  gucugg  cgagg ucau          aggagg guag                a
       ||||||||  ||| | | ||||||  ||||||  ||||| ||||          |||||| ||||                 
3'     cguuuuca  cca c c ccuuac  cggacc  gcucu agua          uucucc cauu                a
   uuuu        ac   c - c      uu      ag     u    aaaaaacaca      -    uaaagguaaccuuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 282785-282951 [-]
intergenic
Database links

Mature sequence gma-miR166b

Accession MIMAT0001678
Sequence

128 - 

ucggaccaggcuucauucccc

 - 148

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).