Stem-loop sequence gma-MIR166a

AccessionMI0001775 (change log)
DescriptionGlycine max miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

39 open access papers mention gma-MIR166a
(226 sentences)

Stem-loop
   -ac      uu   cuu   a        uu      cu   g   c  -ucuuca        --uu      a 
5'    ggaagc  ugu   uug ggggaaug  gucugg  cga gac cu       ucuugauc    guguag c
      ||||||  |||   ||| ||||||||  ||||||  ||| ||| ||       ||||||||    ||||||  
3'    ccuucg  aua   aac ccccuuac  cggacc  gcu uug ga       ggaacugg    cguauc u
   aaa      -u   -uu   c        uu      ag   g   u  uacauaa        uguu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 1934911-1935056 [-]
intergenic
Database links

Mature sequence gma-miR166a-5p

Accession MIMAT0020920
Sequence

23 - 

ggaauguugucuggcucgagg

 - 43

Get sequence
Evidence experimental; Illumina [3]

Mature sequence gma-miR166a-3p

Accession MIMAT0001677
Previous IDsgma-miR166a
Sequence

107 - 

ucggaccaggcuucauucccc

 - 127

Get sequence
Evidence experimental; 454 [1], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).