Stem-loop sequence gma-MIR160a

AccessionMI0001774 (change log)
Previous IDsgma-MIR160
DescriptionGlycine max miR160 stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention gma-MIR160a
(62 sentences)

Stem-loop
       c  ac     ugu      c       cu          ug     c    c  a 
5' caug au  auaug   augugc uggcucc  guaugccauu  uagag ucau ga g
   |||| ||  |||||   |||||| |||||||  ||||||||||  ||||| |||| ||  
3' guac ua  uauac   uauacg accgagg  uaugcgguag  guuuc agua cu c
       a  ca     -uu      a       ag          gu     c    a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 44431708-44431826 [-]
intergenic
Database links

Mature sequence gma-miR160a-5p

Accession MIMAT0001676
Previous IDsgma-miR160
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Evidence experimental; 454 [1]

Mature sequence gma-miR160a-3p

Accession MIMAT0022889
Sequence

82 - 

gcguaugaggagccaagcaua

 - 102

Get sequence
Evidence experimental; Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).