Stem-loop sequence gma-MIR159a

AccessionMI0001773 (change log)
Previous IDsgma-MIR159
DescriptionGlycine max miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

25 open access papers mention gma-MIR159a
(91 sentences)

Stem-loop
   aauu        uuaugaa            ga       uu    aucu    ----   ug   u     g     c      uc      uu     -  ucaaua 
5'     aaagggga       guggagcuccuu  aguccaa  gagg    uacu    ggg  aau gagcu cuuag uaugga  ccacag  cuacc ca      a
       ||||||||       ||||||||||||  |||||||  ||||    ||||    |||  ||| ||||| ||||| ||||||  ||||||  ||||| ||       
3'     uuucuucu       caucucgaggga  uuagguu  uucc    auga    ucc  uua uucga ggguc auaccu  gguguu  gaugg gu      g
   -ucu        cuuccca            ag       uc    aauu    uauu   gu   c     g     u      uc      cu     u  uuucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 40266722-40266935 [+]
intergenic
Database links

Mature sequence gma-miR159a-5p

Accession MIMAT0020919
Sequence

23 - 

gagcuccuugaaguccaauug

 - 43

Get sequence
Evidence experimental; Illumina [3]

Mature sequence gma-miR159a-3p

Accession MIMAT0001675
Previous IDsgma-miR159;gma-miR159a
Sequence

175 - 

uuuggauugaagggagcucua

 - 195

Get sequence
Evidence experimental; 454 [1], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).