Stem-loop sequence gma-MIR156c

AccessionMI0001772
DescriptionGlycine max miR156c stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----ac     cac    cuuau      ccg      ag  u    ac   u      ca  aaaaugcacagauccugauggagauugcacagg 
5'        uugac   uagg     cucuuu   uuucug  ca gcau  uca ucacag  uc                                 g
          |||||   ||||     ||||||   ||||||  || ||||  ||| ||||||  ||                                  
3'        aacug   gucc     gagaga   gaagac  gu ugug  agu aguguu  ag                                 c
   ccuagga     --a    aacac      -ua      -a  -    -a   u      uc  gucucaacucauaccacguuagaucguagugga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr16: 5331672-5331856 [-]
intergenic

Mature sequence gma-miR156c

Accession MIMAT0001674
Sequence

146 - 

uugacagaagauagagagcac

 - 166

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).