Stem-loop sequence gma-MIR156c

AccessionMI0001772 (change log)
DescriptionGlycine max miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156c
(164 sentences)

Stem-loop
   -----ac     cac    cuuau      ccg      ag  u    ac   u      ca  aaaaugcacagauccugauggagauugcacagg 
5'        uugac   uagg     cucuuu   uuucug  ca gcau  uca ucacag  uc                                 g
          |||||   ||||     ||||||   ||||||  || ||||  ||| ||||||  ||                                  
3'        aacug   gucc     gagaga   gaagac  gu ugug  agu aguguu  ag                                 c
   ccuagga     --a    aacac      -ua      -a  -    -a   u      uc  gucucaacucauaccacguuagaucguagugga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 5359989-5360173 [-]
intergenic
Database links

Mature sequence gma-miR156c

Accession MIMAT0001674
Sequence

146 - 

uugacagaagauagagagcac

 - 166

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).