Stem-loop sequence gma-MIR156e

AccessionMI0001771 (change log)
DescriptionGlycine max miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156e
(162 sentences)

Stem-loop
   ---a     u -uu  u    cugc           -         u  u  -   a    -  gaa 
5'     ggagg g   gg gaug    ugacagaagau agagagcac ga ga uga augc au   a
       ||||| |   || ||||    ||||||||||| ||||||||| || || ||| |||| ||    
3'     ccucc c   uc cuac    acugucuucug ucucucgug uu cu acu uacg ua   g
   cucc     - ucu  -    ---u           a         u  c  c   c    g  agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 57144436-57144559 [-]
intergenic
Database links

Mature sequence gma-miR156e

Accession MIMAT0001673
Sequence

21 - 

cugacagaagauagagagcac

 - 41

Get sequence
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2