Stem-loop sequence gma-MIR156d

AccessionMI0001770 (change log)
DescriptionGlycine max miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156d
(171 sentences)

Stem-loop
   --cuacuu   aauu     u u         -              u  -   u       uuauauaauauauagc 
5'         ggu    aaggu g ugacagaag auagagagcacaga ga uga augcaua                a
           |||    ||||| | ||||||||| |||||||||||||| || ||| |||||||                 
3'         ccg    uucca c acugucuuc uaucucucguguuu cu auu uacgugu                g
   cuuuaccu   --ac     - u         a              c  c   c       uaaguaguacucaagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 3896578-3896728 [+]
intergenic
Database links

Mature sequence gma-miR156d

Accession MIMAT0001672
Sequence

21 - 

uugacagaagauagagagcac

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).