|
miRBase |
|
Stem-loop sequence sof-MIR156 |
|
| Accession | MI0001754 |
| Description | Saccharum officinarum miR156 stem-loop |
| Gene family | MIPF0000008; MIR156 |
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA. |
| Stem-loop |
ggu a --gugga - - a gccu uu ugaacg g ggaga gag ggcugacaga agaga gugagcac cauggu uuc gcauga auc a ||||| ||| |||||||||| ||||| |||||||| |||||| ||| |||||| ||| ucucu cuc ccgacugucu ucucu cacucgug guaucg aag cguacu ugg g --c - aagauug c u c ---- cu ------ a |
Mature sequence sof-miR156 |
|
| Accession | MIMAT0001656 |
| Sequence |
21 - ugacagaagagagugagcac - 40 |
| Evidence | by similarity; MI0000654 |
References |
|
| 1 |
PMID:15916721
"Identification and characterization of new plant microRNAs using EST analysis"
Cell Res. 15:336-360(2005).
|
| 2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|