Stem-loop sequence mtr-MIR156a

AccessionMI0001752 (change log)
Previous IDsmtr-MIR156
DescriptionMedicago truncatula miR156 stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   agccau  --au   uc  a     c      -        aca    cc     acaaguaacaaaaaacuaccaacuaucaacauuuugucuacuaugaagaaaaucacaugucuagacuauaguuacgaauggaagauacauucaaugauguuuaugaaaauuugagacggucgaggacuauaguuacucuaucgcauacauuuaaugacaaaaaaaauuguguacucuua 
5'       ga    cag  cg gauga agaaga gagagagc   ccca  ugauu                                                                                                                                                                                   u
         ||    |||  || ||||| |||||| ||||||||   ||||  |||||                                                                                                                                                                                    
3'       cu    guc  gu uuacu ucuucu cuuucucg   gggu  acuaa                                                                                                                                                                                   u
   ---ccu  gacc   cc  g     c      u        --a    --     gacaacccuccuuaaggaguguuccauuuugaacugagaaugaauaacguuuuagauuacuaaaaaaaugguacuauaaaugaaaaaaacuuguuaaaaaaaugguacuauaacuuacguuaaaaaauaugacguaaaacuaagaacguaucuuuaacuuacuucuacauaacuuuuau 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_50145: 402-861 [-]
Database links

Mature sequence mtr-miR156a

Accession MIMAT0001654
Previous IDsmtr-miR156

21 - 


 - 41

Get sequence
Evidence experimental; 454 [2], Northern [2]


"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D (2005).
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).