Stem-loop sequence mtr-MIR399a

AccessionMI0001749 (change log)
DescriptionMedicago truncatula miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399a
(24 sentences)

Stem-loop
   ucca        uu    ua a   ug   u    a         a  uagu     ---u     a     
5'     aguugcag  gaau  c ggg  agu cucc uuggcaggu gc    cacua    augau ugca 
       ||||||||  ||||  | |||  ||| |||| ||||||||| ||    |||||    ||||| ||| u
3'     ucaacguc  cuua  g ccc  uua gagg aaccgucua cg    gugau    uacua acgu 
   -auc        cu    gc a   gu   -    a         a  ---u     ucuu     -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 23163782-23163915 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399a
mtr-MIR399gchr8: 24230599-24230702 [+]
mtr-MIR399fchr8: 24222878-24222981 [+]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399fchr8: 24153821-24153924 [+]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399fchr8: 23986801-23986904 [+]
mtr-MIR399fchr8: 23166508-23166611 [-]
mtr-MIR399achr8: 23163782-23163915 [-]
mtr-MIR399gchr8: 23158805-23158908 [-]
Database links

Mature sequence mtr-miR399a

Accession MIMAT0001651
Sequence

95 - 

ugccaaaggagauuugcccag

 - 115

Get sequence
Evidence experimental; Northern [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).