Stem-loop sequence mtr-MIR393a

AccessionMI0001745 (change log)
Previous IDsmtr-MIR393
DescriptionMedicago truncatula miR393 stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mtr-MIR393a
(8 sentences)

Stem-loop
   aacu  a   u       c            c    u       uaauauuucaacuuuagucacuu 
5'     gc acu gaggagg auccaaagggau gcau gauccua                       u
       || ||| ||||||| |||||||||||| |||| |||||||                       a
3'     cg uga uuccucu uagguuucccua cgua cuagggu                       a
   -cau  a   u       u            c    -       uaauucauaauauacucucuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 21952259-21952393 [+]
intergenic
Database links

Mature sequence mtr-miR393a

Accession MIMAT0001647
Previous IDsmtr-miR393
Sequence

21 - 

uccaaagggaucgcauugauc

 - 41

Get sequence
Evidence experimental; Northern [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).