Stem-loop sequence mtr-MIR166a

AccessionMI0001740 (change log)
Previous IDsmtr-MIR166
DescriptionMedicago truncatula miR166 stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166a
(42 sentences)

Stem-loop
   cagac    gaag     ca         u     a       c     guca    uaaa 
5'      auac    gaguu  ggggaaugg gucug uucgaga cauuc    caag    c
        ||||    |||||  ||||||||| ||||| ||||||| |||||    ||||    a
3'      uaug    cucga  ccccuuacu cggac aggcucu guaag    guuc    g
   cguac    -aua     uc         u     c       a     ---a    cgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 19059643-19059763 [-]
intergenic
Database links

Mature sequence mtr-miR166a

Accession MIMAT0001642
Previous IDsmtr-miR166
Sequence

82 - 

ucggaccaggcuucauucccc

 - 102

Get sequence
Evidence experimental; 454 [2], Northern [2], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).