Stem-loop sequence mtr-MIR160a

AccessionMI0001739 (change log)
Previous IDsmtr-MIR160
DescriptionMedicago truncatula miR160 stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention mtr-MIR160a
(16 sentences)

Stem-loop
   --   -u        uaauu      c       c           ug -     u      g 
5'   aga  auauauac     gcgugc uggcucc uguaugccauu  u agagu caucaa a
     |||  ||||||||     |||||| ||||||| |||||||||||  | ||||| ||||||  
3'   ucu  uauaugug     uguacg accgagg gcgugcgguaa  a uuuca guaguu u
   ua   uu        ----u      u       a           gu a     -      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_112492: 316-434 [+]
intergenic
Database links

Mature sequence mtr-miR160a

Accession MIMAT0001641
Previous IDsmtr-miR160
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).