Stem-loop sequence hsa-mir-409

AccessionMI0001735 (change log)
Symbol HGNC:MIR409
DescriptionHomo sapiens miR-409 stem-loop
Gene family MIPF0000018; mir-154
Literature search

56 open access papers mention hsa-mir-409
(185 sentences)

Stem-loop
   u     u  gg   a    ac         -    - auc 
5'  gguac cg  gag gguu  ccgagcaac uuug c   u
    ||||| ||  ||| ||||  ||||||||| |||| |    
3'  cuaug gc  uuc ccaa  ggcucguug aagc g   g
   a     -  uu   c    gu         u    a cag 
Get sequence
Deep sequencing
19718 reads, 3.91 reads per million, 128 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101065300-101065378 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-409
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-409-5p

Accession MIMAT0001638
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Deep sequencing5896 reads, 106 experiments
Evidence experimental; cloned [1,3-4]
Database links
Predicted targets

Mature sequence hsa-miR-409-3p

Accession MIMAT0001639
Sequence

47 - 

gaauguugcucggugaaccccu

 - 68

Get sequence
Deep sequencing13819 reads, 128 experiments
Evidence experimental; cloned [1,3-4], array-cloned [2]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).