|
miRBase |
|
Stem-loop sequence hsa-mir-409 |
|||||
| Accession | MI0001735 | ||||
| Symbol | HGNC:MIR409 | ||||
| Description | Homo sapiens miR-409 stem-loop | ||||
| Gene family | MIPF0000018; mir-154 | ||||
| Stem-loop |
u u gg a ac - - auc gguac cg gag gguu ccgagcaac uuug c u ||||| || ||| |||| ||||||||| |||| | cuaug gc uuc ccaa ggcucguug aagc g g a - uu c gu u a cag |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-409-5p |
|
| Accession | MIMAT0001638 |
| Sequence |
15 - agguuacccgagcaacuuugcau - 37 |
| Deep sequencing | 225 reads, 11 experiments |
| Evidence | experimental; cloned [1,3-4] |
| Predicted targets |
|
Mature sequence hsa-miR-409-3p |
|
| Accession | MIMAT0001639 |
| Sequence |
47 - gaauguugcucggugaaccccu - 68 |
| Deep sequencing | 671 reads, 5 experiments |
| Evidence | experimental; cloned [1,3-4], array-cloned [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|