Stem-loop sequence hsa-mir-452

AccessionMI0001733
Symbol HGNC:MIR452
DescriptionHomo sapiens miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
     u          aac g        g  a        uuug 
5' gc aagcacuuac   u uuugcaga ga acugagac    u
   || ||||||||||   | |||||||| || ||||||||    a
3' cg uucgugaaug   a aaacgucu cu ugacucug    a
     u          --a g        a  c        uauc 
Get sequence
Deep sequencing
15626 reads, 729 reads per million, 56 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 151959628-151959712 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-452
hsa-mir-452chrX: 151959628-151959712 [-]
hsa-mir-224chrX: 151958578-151958658 [-]
Database links

Mature sequence hsa-miR-452-5p

Accession MIMAT0001635
Previous IDshsa-miR-452
Sequence

14 - 

aacuguuugcagaggaaacuga

 - 35

Get sequence
Deep sequencing1622 reads, 48 experiments
Evidence experimental; cloned [1,3-5], array-cloned [2]
Predicted targets

Mature sequence hsa-miR-452-3p

Accession MIMAT0001636
Previous IDshsa-miR-452*
Sequence

58 - 

cucaucugcaaagaaguaagug

 - 79

Get sequence
Deep sequencing160 reads, 24 experiments
Evidence experimental; array-cloned [2], cloned [4]
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).