Stem-loop sequence hsa-mir-452

Accession

MI0001733

Symbol

HGNC:MIR452

Description

Homo sapiens miR-452 stem-loop

Gene family

MIPF0000287; mir-452

Stem-loop

  u          aac g        g  a        uuug 
gc aagcacuuac   u uuugcaga ga acugagac    u
|| ||||||||||   | |||||||| || ||||||||    a
cg uucgugaaug   a aaacgucu cu ugacucug    a
  u          --a g        a  c        uauc 

Deep sequencing

1296 reads, 17 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chrX: 151128100-151128184 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000060909 ; GABRE-007; exon 1

  OTTHUMT00000060909 ; GABRE-007; exon 1

  OTTHUMT00000060909 ; GABRE-007; exon 1

  OTTHUMT00000346524 ; GABRE-013; intron 2

  OTTHUMT00000346524 ; GABRE-013; intron 2

  OTTHUMT00000346524 ; GABRE-013; intron 2

  OTTHUMT00000060905 ; GABRE-003; intron 5

  OTTHUMT00000060905 ; GABRE-003; intron 5

  OTTHUMT00000060905 ; GABRE-003; intron 5

  OTTHUMT00000060903 ; GABRE-001; intron 6

  OTTHUMT00000060904 ; GABRE-002; intron 6

  OTTHUMT00000060907 ; GABRE-005; intron 6

  OTTHUMT00000060903 ; GABRE-001; intron 6

  OTTHUMT00000060904 ; GABRE-002; intron 6

  OTTHUMT00000060907 ; GABRE-005; intron 6

  OTTHUMT00000060903 ; GABRE-001; intron 6

  OTTHUMT00000060904 ; GABRE-002; intron 6

  OTTHUMT00000060907 ; GABRE-005; intron 6

  ENST00000486255 ; GABRE-007; exon 1

  ENST00000486255 ; GABRE-007; exon 1

  ENST00000486255 ; GABRE-007; exon 1

  ENST00000476016 ; GABRE-013; intron 2

  ENST00000476016 ; GABRE-013; intron 2

  ENST00000476016 ; GABRE-013; intron 2

  ENST00000425556 ; GABRE-003; intron 5

  ENST00000425556 ; GABRE-003; intron 5

  ENST00000425556 ; GABRE-003; intron 5

  ENST00000370328 ; GABRE-001; intron 6

  ENST00000370325 ; GABRE-002; intron 6

  ENST00000441219 ; GABRE-005; intron 6

  ENST00000393914 ; GABRE-201; intron 6

  ENST00000370328 ; GABRE-001; intron 6

  ENST00000370325 ; GABRE-002; intron 6

  ENST00000441219 ; GABRE-005; intron 6

  ENST00000393914 ; GABRE-201; intron 6

  ENST00000370328 ; GABRE-001; intron 6

  ENST00000370325 ; GABRE-002; intron 6

  ENST00000441219 ; GABRE-005; intron 6

  ENST00000393914 ; GABRE-201; intron 6

Clustered miRNAs

< 10kb from hsa-mir-452

• hsa-mir-452: chrX: 151128100-151128184 [-]
• hsa-mir-224: chrX: 151127050-151127130 [-]

Database links

• EMBL: AY785920;AY785920
• EMBL: AY882269;AY882269
• ENTREZGENE: 574412;MIR452
• HGNC: 32054;MIR452

Mature sequence hsa-miR-452-5p

• Accession: MIMAT0001635
• Previous IDs: hsa-miR-452
• Sequence: 14 - aacuguuugcagaggaaacuga - 35
• Deep sequencing: 1291 reads, 15 experiments
• Evidence: experimental; cloned [1,3-5], array-cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-452-5p
  • MICRORNA.ORG:hsa-miR-452-5p
  • MIRDB:hsa-miR-452-5p
  • RNA22-HSA:hsa-miR-452-5p
  • TARGETMINER:hsa-miR-452-5p
  • TARGETSCAN-VERT:hsa-miR-452

Mature sequence hsa-miR-452-3p

• Accession: MIMAT0001636
• Previous IDs: hsa-miR-452*
• Sequence: 58 - cucaucugcaaagaaguaagug - 79
• Deep sequencing: 4 reads, 2 experiments
• Evidence: experimental; array-cloned [2], cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-452-3p
  • MICRORNA.ORG:hsa-miR-452-3p
  • MIRDB:hsa-miR-452-3p
  • RNA22-HSA:hsa-miR-452-3p
  • TARGETMINER:hsa-miR-452-3p

References

1. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).