Stem-loop sequence rno-mir-451

AccessionMI0001731 (change log)
DescriptionRattus norvegicus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

51 open access papers mention rno-mir-451
(222 sentences)

Stem-loop
   uu     au      ga                 a 
5'   uggga  ggcgag  aaccguuaccauuacug g
     |||||  ||||||  |||||||||||||||||  
3'   acccu  ucguuc  uugguaaugguaaugau u
   ac     cg      uc                 u 
Get sequence
Deep sequencing
536183 reads, 316 reads per million, 495 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 65291204-65291275 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-451
rno-mir-144chr10: 65291365-65291447 [-]
rno-mir-451chr10: 65291204-65291275 [-]
Database links

Mature sequence rno-miR-451-5p

Accession MIMAT0001633
Previous IDsrno-miR-451
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Deep sequencing533676 reads, 495 experiments
Evidence experimental; cloned [2], Northern [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-451-3p

Accession MIMAT0017193
Previous IDsrno-miR-451*
Sequence

44 - 

augguaaugguucucuugcugcu

 - 66

Get sequence
Deep sequencing2486 reads, 199 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).