Stem-loop sequence mmu-mir-451a

Accession MI0001730
Previous IDs mmu-mir-451
Symbol MGI:Mir451
Description Mus musculus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cu     au      ga                 a 
  uggga  ggcgag  aaccguuaccauuacug g
  |||||  ||||||  |||||||||||||||||  
  acccu  ucguuc  uuggcaaugguaaugau u
ac     cg      uc                 u 
Get sequence
Deep sequencing
272429 reads, 94 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 78073170-78073241 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-451a
mmu-mir-144 chr11: 78073005-78073070 [+]
mmu-mir-451b chr11: 78073170-78073241 [-]
mmu-mir-451a chr11: 78073170-78073241 [+]
Database links

Mature sequence mmu-miR-451a

Accession MIMAT0001632
Previous IDs mmu-miR-451
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Deep sequencing 271256 reads, 79 experiments
Evidence experimental; cloned [1-3], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).