Stem-loop sequence hsa-mir-451a

Accession

MI0001729

Previous IDs

hsa-mir-451

Symbol

HGNC:MIR451

Description

Homo sapiens miR-451a stem-loop

Gene family

MIPF0000148; mir-451

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Stem-loop

c     a        ga                 a 
 uuggg auggcaag  aaccguuaccauuacug g
 ||||| ||||||||  |||||||||||||||||  
 gaccc uaucguuc  uugguaaugguaaugau u
a     a        uc                 u 

Deep sequencing

2322 reads, 37 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh37.p5): chr17: 27188387-27188458 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000446722 ; RP11-20B24.2-001; exon 1

  ENST00000582320 ; MIR451B-001; exon 1

  antisense

  OTTHUMT00000447013 ; RP11-20B24.9-001; exon 1

  ENST00000580595 ; MIR451B-001; exon 1

Clustered miRNAs

< 10kb from hsa-mir-451a

• hsa-mir-4732: chr17: 27188673-27188748 [-]
• hsa-mir-144: chr17: 27188551-27188636 [-]
• hsa-mir-451b: chr17: 27188389-27188456 [+]
• hsa-mir-451a: chr17: 27188387-27188458 [-]

Database links

• ENTREZGENE: 574411;MIR451
• HGNC: 32053;MIR451

Mature sequence hsa-miR-451a

• Accession: MIMAT0001631
• Previous IDs: hsa-miR-451
• Sequence: 17 - aaaccguuaccauuacugaguu - 38
• Deep sequencing: 2319 reads, 37 experiments
• Evidence: experimental; cloned [1-3]
• Validated targets:
  • TARBASE:hsa-miR-451a
• Predicted targets:
  • DIANA-MICROT:hsa-miR-451a
  • MICRORNA.ORG:hsa-miR-451a
  • MIRDB:hsa-miR-451a
  • RNA22-HSA:hsa-miR-451a
  • TARGETMINER:hsa-miR-451a
  • TARGETSCAN-VERT:hsa-miR-451

References

1. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).