Stem-loop sequence hsa-mir-451a

AccessionMI0001729 (change log)
Previous IDshsa-mir-451
Symbol HGNC:MIR451A
DescriptionHomo sapiens miR-451a stem-loop
Gene family MIPF0000148; mir-451
Literature search

287 open access papers mention hsa-mir-451a
(1367 sentences)

Stem-loop
   c     a        ga                 a 
5'  uuggg auggcaag  aaccguuaccauuacug g
    ||||| ||||||||  |||||||||||||||||  
3'  gaccc uaucguuc  uugguaaugguaaugau u
   a     a        uc                 u 
Get sequence
Deep sequencing
1666747 reads, 3.86e+03 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 28861369-28861440 [-]
antisense
OTTHUMT00000443628 ; ALOX12P1-001; intron 3
ENST00000579299 ; ALOX12P1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-451a
hsa-mir-4732chr17: 28861655-28861730 [-]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-451achr17: 28861369-28861440 [-]
Database links

Mature sequence hsa-miR-451a

Accession MIMAT0001631
Previous IDshsa-miR-451
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Deep sequencing1666621 reads, 147 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).