Stem-loop sequence hsa-mir-451a

AccessionMI0001729
Previous IDshsa-mir-451
Symbol HGNC:MIR451
DescriptionHomo sapiens miR-451a stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c     a        ga                 a 
5'  uuggg auggcaag  aaccguuaccauuacug g
    ||||| ||||||||  |||||||||||||||||  
3'  gaccc uaucguuc  uugguaaugguaaugau u
   a     a        uc                 u 
Get sequence
Deep sequencing
251117 reads, 6.77e+03 reads per million, 59 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 28861369-28861440 [-]
antisense
OTTHUMT00000443628 ; ALOX12P1-001; intron 3
ENST00000579299 ; ALOX12P1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-451a
hsa-mir-4732chr17: 28861655-28861730 [-]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-451achr17: 28861369-28861440 [-]
Database links

Mature sequence hsa-miR-451a

Accession MIMAT0001631
Previous IDshsa-miR-451
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Deep sequencing1731 reads, 46 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).