Stem-loop sequence rno-mir-433

AccessionMI0001724 (change log)
DescriptionRattus norvegicus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     gg      gua   u           u   --------  g     cu 
5' cc  ggagaa   cgg gagccugucau auu        ca agagg  a
   ||  ||||||   ||| ||||||||||| |||        || |||||   
3' gg  ccucuu   gcu cucggguagua uag        gu ucucc  g
     -a      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
5007 reads, 22.2 reads per million, 27 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133712334-133712426 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 5
Clustered miRNAs
< 10kb from rno-mir-433
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-433-5p

Accession MIMAT0017192
Previous IDsrno-miR-433*
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Deep sequencing656 reads, 13 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-433-3p

Accession MIMAT0001628
Previous IDsrno-miR-433
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Deep sequencing4350 reads, 27 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).