Stem-loop sequence rno-mir-433

AccessionMI0001724 (change log)
DescriptionRattus norvegicus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

14 open access papers mention rno-mir-433
(193 sentences)

Stem-loop
     gg      gua   u           u   --------  g     cu 
5' cc  ggagaa   cgg gagccugucau auu        ca agagg  a
   ||  ||||||   ||| ||||||||||| |||        || |||||   
3' gg  ccucuu   gcu cucggguagua uag        gu ucucc  g
     -a      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
74885 reads, 49.8 reads per million, 329 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133712334-133712426 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 5
Clustered miRNAs
< 10kb from rno-mir-433
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-433-5p

Accession MIMAT0017192
Previous IDsrno-miR-433*
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Deep sequencing9206 reads, 204 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-433-3p

Accession MIMAT0001628
Previous IDsrno-miR-433
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Deep sequencing65675 reads, 322 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).