Stem-loop sequence hsa-mir-433

AccessionMI0001723 (change log)
Symbol HGNC:MIR433
DescriptionHomo sapiens miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     gg      gua   u           u   --------  g     cu 
5' cc  ggagaa   cgg gagccugucau auu        ca agagg  a
   ||  ||||||   ||| ||||||||||| |||        || |||||   
3' gg  ccucuu   gcu cucggguagua uag        gu ucucc  g
     -a      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
1473 reads, 6.25 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100881886-100881978 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-433
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-433-5p

Accession MIMAT0026554
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Deep sequencing76 reads, 17 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-433-3p

Accession MIMAT0001627
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Deep sequencing1395 reads, 31 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).