Stem-loop sequence hsa-mir-433

Accession MI0001723
Symbol HGNC:MIR433
Description Homo sapiens miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  gg      gua   u           u   --------  g     cu 
cc  ggagaa   cgg gagccugucau auu        ca agagg  a
||  ||||||   ||| ||||||||||| |||        || |||||   
gg  ccucuu   gcu cucggguagua uag        gu ucucc  g
  -a      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
794 reads, 17 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 101348223-101348315 [+]
sense
ENST00000384837 ; MIR433-201; exon 1
ENST00000384837 ; MIR433-201; exon 1
ENST00000384837 ; MIR433-201; exon 1
antisense
OTTHUMT00000395127 ; RTL1-001; exon 1
OTTHUMT00000395127 ; RTL1-001; exon 1
OTTHUMT00000395127 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-433
hsa-mir-337 chr14: 101340830-101340922 [+]
hsa-mir-665 chr14: 101341370-101341441 [+]
hsa-mir-431 chr14: 101347344-101347457 [+]
hsa-mir-433 chr14: 101348223-101348315 [+]
hsa-mir-127 chr14: 101349316-101349412 [+]
hsa-mir-432 chr14: 101350820-101350913 [+]
hsa-mir-136 chr14: 101351039-101351120 [+]
Database links

Mature sequence hsa-miR-433

Accession MIMAT0001627
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Deep sequencing 764 reads, 10 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).