Stem-loop sequence rno-mir-431

AccessionMI0001722 (change log)
DescriptionRattus norvegicus miR-431 stem-loop
Gene family MIPF0000142; mir-431
Stem-loop
   uccugcgcguccugcgaggugucuugcaggccgucaugcaggccacacugacgguaacguugcag          ag g 
5'                                                                  gucgucuugc  g c
                                                                    ||||||||||  |  
3'                                                                  cagcagaacg  c u
   ----------------------------------------------gcagcaaccgcuacuucua          cu u 
Get sequence
Deep sequencing
15101 reads, 80 reads per million, 30 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133711425-133711538 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 5
Clustered miRNAs
< 10kb from rno-mir-431
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-431

Accession MIMAT0001626
Sequence

20 - 

ugucuugcaggccgucaugca

 - 40

Get sequence
Deep sequencing12294 reads, 30 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).