Stem-loop sequence hsa-mir-431

AccessionMI0001721 (change log)
Symbol HGNC:MIR431
DescriptionHomo sapiens miR-431 stem-loop
Gene family MIPF0000142; mir-431
Literature search

28 open access papers mention hsa-mir-431
(46 sentences)

Stem-loop
   ---------------ucc  c     c       u          c  u a     ----   aca 
5'                   ug uuguc ugcgagg gucuugcagg cg c ugcag    gcc   c
                     || ||||| ||||||| |||||||||| || | |||||    |||    
3'                   ac agcag acgcucu cgggacguuc gc g acguu    ugg   u
   gcagcaaccacuacuccu  -     a       u          u  u g     gcaa   cag 
Get sequence
Deep sequencing
3155 reads, 0 reads per million, 93 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100881007-100881120 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-431
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-431-5p

Accession MIMAT0001625
Previous IDshsa-miR-431
Sequence

20 - 

ugucuugcaggccgucaugca

 - 40

Get sequence
Deep sequencing224 reads, 59 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-431-3p

Accession MIMAT0004757
Previous IDshsa-miR-431*
Sequence

63 - 

caggucgucuugcagggcuucu

 - 84

Get sequence
Deep sequencing2880 reads, 76 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).