Stem-loop sequence osa-MIR444a

AccessionMI0001719 (change log)
Previous IDsosa-MIR444
DescriptionOryza sativa miR444a stem-loop
Gene family MIPF0000402; MIR444
Literature search

27 open access papers mention osa-MIR444a
(74 sentences)

Stem-loop
   au     u              a    ug                      -  ug    -c  a 
5'   gcaau gggggcagcaagcu gagg  gcaacugcauaauuugcaagaa au  uugg  ug a
     ||||| |||||||||||||| ||||  |||||||||||||||||||||| ||  ||||  || g
3'   cguug ccuccgucguucga cucc  cguugacguauugaacguucuu ua  agcc  ac a
   ac     u              a    gu                      a  gu    au  u 
Get sequence
Deep sequencing
1737 reads, 900 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR444a-5p

Accession MIMAT0020918
Sequence

20 - 

gcuagagguggcaacugcaua

 - 40

Get sequence
Deep sequencing242 reads, 2 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence osa-miR444a-3p.2

Accession MIMAT0005790
Previous IDsosa-miR444a.2
Sequence

94 - 

ugcaguugcugccucaagcuu

 - 114

Get sequence
Deep sequencing1414 reads, 2 experiments
Evidence experimental; MPSS [2], Northern [2]
Database links

Mature sequence osa-miR444a-3p.1

Accession MIMAT0001617
Previous IDsosa-MIR444;osa-miR444;osa-miR444a.1
Sequence

99 - 

uugcugccucaagcuugcugc

 - 119

Get sequence
Deep sequencing707 reads, 2 experiments
Evidence experimental; cloned [1], MPSS [2], Northern [2]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).