Stem-loop sequence osa-MIR443

AccessionMI0001708 (change log)
DescriptionOryza sativa miR443 stem-loop
Literature search

2 open access papers mention osa-MIR443
(2 sentences)

Stem-loop
        --cau         ccc      ----ag            a  a                     --   a 
5' cgucc     aaaaacaaa   aaaacu      augugauauauc ca uacaauaaaucuggauaggag  ucu u
   |||||     |||||||||   ||||||      |||||||||||| || |||||||||||||||||||||  |||  
3' gcagg     uuuuuguuu   uuuuga      uacacuguauag gu auguuauuuagaucuaucuuc  aga c
        uuuuu         aua      cuuaua            g  c                     au   c 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 30021449-30021596 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR443
osa-MIR443Chr3: 30021449-30021596 [+]
osa-MIR171fChr3: 30027774-30027900 [+]
Database links

Mature sequence osa-miR443

Accession MIMAT0001606
Previous IDsosa-MIR443
Sequence

38 - 

aucacaauacaauaaaucugga

 - 59

Get sequence
Deep sequencing116 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).