Stem-loop sequence osa-MIR440

AccessionMI0001701 (change log)
DescriptionOryza sativa miR440 stem-loop
Literature search

2 open access papers mention osa-MIR440
(2 sentences)

Stem-loop
         a ug      c   g  c          c        u     caa  -    cc 
5' auugcu u  uuggug ugg cu guccugauca uaggagac cugau   gc uagg  u
   |||||| |  |||||| ||| || |||||||||| |||||||| |||||   || ||||   
3' uagcga a  agccac auc ga cagggcuagu guccucug gauua   ug auuc  a
         g gu      a   g  a          a        u     ---  u    aa 
Get sequence
Deep sequencing
104 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 9164805-9164924 [-]
intergenic
Database links

Mature sequence osa-miR440

Accession MIMAT0001599
Previous IDsosa-MIR440
Sequence

75 - 

agugucuccugaugaucgggacaa

 - 98

Get sequence
Deep sequencing84 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).