Stem-loop sequence osa-MIR439i

AccessionMI0001700 (change log)
DescriptionOryza sativa miR439i stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439i
(2 sentences)

Stem-loop
         -  a    c     g -a u        ggggcguggcuacagugacacuacaaugu 
5' gcaggg ac uauc aacgg c  g guucgaua                             u
   |||||| || |||| ||||| |  | ||||||||                              
3' uguccc ug auag uuguu g  c caagcugu                             u
         a  g    c     g cg -        acacuaauuuauuaaaauuuuuaucuuuu 
Get sequence
Deep sequencing
233 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR439i

Accession MIMAT0001598
Previous IDsosa-MIR439j
Sequence

93 - 

ugucgaaccgcgguuguucga

 - 113

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).