Stem-loop sequence osa-MIR439h

AccessionMI0001698 (change log)
DescriptionOryza sativa miR439h stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439h
(2 sentences)

Stem-loop
   accacc             uca   a        --u             ug 
5'       uacccugucgaac   cgc guucgaca   guaccugucgaac  u
         |||||||||||||   ||| ||||||||   |||||||||||||  g
3'       gugggacagcuug   gcg caagcugu   uauggauagcuug  g
   ------             uug   c        ccc             uu 
Get sequence
Deep sequencing
208 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 1553119-1553217 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR439h
osa-MIR399dChr6: 1561789-1562074 [+]
osa-MIR439hChr6: 1553119-1553217 [-]
Database links

Mature sequence osa-miR439h

Accession MIMAT0001596
Previous IDsosa-MIR439h
Sequence

72 - 

ugucgaaccgcgguuguucga

 - 92

Get sequence
Deep sequencing74 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).