Stem-loop sequence osa-MIR439g

AccessionMI0001697 (change log)
DescriptionOryza sativa miR439g stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439g
(2 sentences)

Stem-loop
   u          uga   a        --u             ug 
5'  ccugucgaac   cgc guucgaca   guaccugucgaac  u
    ||||||||||   ||| ||||||||   |||||||||||||  g
3'  ggacagcuug   gcg caagcugu   uauggauagcuug  g
   -          uug   c        ccc             uu 
Get sequence
Deep sequencing
184 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3664228-3664315 [+]
intergenic
Database links

Mature sequence osa-miR439g

Accession MIMAT0001595
Previous IDsosa-MIR439g
Sequence

64 - 

ugucgaaccgcgguuguucga

 - 84

Get sequence
Deep sequencing51 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).