Stem-loop sequence osa-MIR439e

AccessionMI0001695 (change log)
DescriptionOryza sativa miR439e stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439e
(2 sentences)

Stem-loop
   ccacc             uga   a        --u             ug 
5'      uacccugucgaac   cgc guucgaca   guaccugucgaac  u
        |||||||||||||   ||| ||||||||   |||||||||||||  g
3'      gugggacagcuug   gcg caagcugu   uauggauagcuug  g
   -----             uug   c        ccc             uu 
Get sequence
Deep sequencing
214 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 15057569-15057666 [-]
intergenic
Database links

Mature sequence osa-miR439e

Accession MIMAT0001593
Previous IDsosa-MIR439e
Sequence

71 - 

ugucgaaccgcgguuguucga

 - 91

Get sequence
Deep sequencing74 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).