Stem-loop sequence osa-MIR439b

AccessionMI0001692 (change log)
DescriptionOryza sativa miR439b stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439b
(2 sentences)

Stem-loop
   uu          ug g  u          u 
5'   ccugucgaau  u gu guucgauagg a
     ||||||||||  | || ||||||||||  
3'   ggacagcuug  g cg caagcugucc c
   --          uu g  c          c 
Get sequence
Deep sequencing
98 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 5572922-5572981 [+]
intergenic
Database links

Mature sequence osa-miR439b

Accession MIMAT0001590
Previous IDsosa-MIR439b
Sequence

36 - 

ugucgaaccgcgguuguucga

 - 56

Get sequence
Deep sequencing53 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).