Stem-loop sequence osa-MIR439a

AccessionMI0001691 (change log)
DescriptionOryza sativa miR439a stem-loop
Gene family MIPF0000092; MIR439
Literature search

2 open access papers mention osa-MIR439a
(2 sentences)

Stem-loop
                uga   a        --u             ug 
5' uacccugucgaac   cgc guucgaca   guaccugucgaac  u
   |||||||||||||   ||| ||||||||   |||||||||||||  g
3' gugggacagcuug   gcg caagcugu   uauggauagcuug  g
                uug   c        ccc             uu 
Get sequence
Deep sequencing
209 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 19880143-19880235 [+]
intergenic
Database links

Mature sequence osa-miR439a

Accession MIMAT0001589
Previous IDsosa-MIR439a
Sequence

66 - 

ugucgaaccgcgguuguucga

 - 86

Get sequence
Deep sequencing74 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).