Stem-loop sequence osa-MIR390

AccessionMI0001690 (change log)
DescriptionOryza sativa miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

37 open access papers mention osa-MIR390
(196 sentences)

Stem-loop
       u       u  u  a         g           c aaa 
5' ggua ggaacaa cc ug agcucagga ggauagcgccu g   u
   |||| ||||||| || || ||||||||| ||||||||||| |    
3' ccau ucuuguu gg ac ucgaguccu ucuaucgcgga c   c
       -       u  u  c         a           u aaa 
Get sequence
Deep sequencing
526 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 34275140-34275230 [-]
intergenic
Database links

Mature sequence osa-miR390-5p

Accession MIMAT0001588
Previous IDsosa-MIR390;osa-miR390
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Deep sequencing466 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence osa-miR390-3p

Accession MIMAT0022888
Sequence

56 - 

cgcuaucuauccugagcucc

 - 75

Get sequence
Deep sequencing58 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).