Stem-loop sequence osa-MIR437

AccessionMI0001688 (change log)
DescriptionOryza sativa miR437 stem-loop
Gene family MIPF0000746; MIR437
Literature search

8 open access papers mention osa-MIR437
(14 sentences)

Stem-loop
                  ug  uu      u         g         a      u                   u     aauuaacaucuaaaau     au     -ca  a 
5' cccucuguuucauau  ua  guguuu aguuuuguu uaagucaaa uucuuu acuuugaccaaguuuguag aaaau                accaa  aaaua   cu u
   |||||||||||||||  ||  |||||| ||||||||| ||||||||| |||||| ||||||||||||||||||| |||||                |||||  |||||   ||  
3' gggagacaagguaua  au  cacaaa ucaaaacag auucaguuu aagaga ugaaacugguucaaauauc uuuua                ugguu  uuuau   ga u
                  gu  uc      -         g         g      u                   u     --------------gu     -c     aca  g 
Get sequence
Deep sequencing
161 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 17050336-17050548 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR437
osa-MIR437Chr2: 17050336-17050548 [-]
osa-MIR5147Chr2: 17049859-17050224 [-]
Database links

Mature sequence osa-miR437

Accession MIMAT0001586
Previous IDsosa-MIR437
Sequence

155 - 

aaaguuagagaaguuugacuu

 - 175

Get sequence
Deep sequencing31 reads, 2 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).