Stem-loop sequence hcmv-mir-US33

AccessionMI0001686 (change log)
Previous IDshcv-miR-US33-1;hcmv-mir-US33-1
DescriptionHuman cytomegalovirus miR-US33 stem-loop
Stem-loop
       g   au     c          g  c acga 
5' cacg uug  ugugc cggaccgugg cg g    a
   |||| |||  ||||| |||||||||| || |     
3' gugc aac  acacg gccuggcacu gc c    a
       a   cu     a          -  - accc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 220470-220539 [-]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US33
hcmv-mir-US33HEHCMVCG: 220470-220539 [-]
hcmv-mir-US29HEHCMVCG: 220469-220540 [+]
hcmv-mir-US25-2HEHCMVCG: 215447-215536 [-]
hcmv-mir-US25-1HEHCMVCG: 215245-215314 [-]
Database links

Mature sequence hcmv-miR-US33-5p

Accession MIMAT0001584
Previous IDshcv-miR-US33-1;hcmv-miR-US33-1;hcmv-miR-US33
Sequence

8 - 

gauugugcccggaccgugggcg

 - 29

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

Mature sequence hcmv-miR-US33-3p

Accession MIMAT0004756
Sequence

45 - 

ucacgguccgagcacauccaa

 - 65

Get sequence
Evidence experimental; cloned [2], Illumina [3-4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).