Stem-loop sequence hcmv-mir-US25-2

AccessionMI0001685 (change log)
Previous IDshcv-miR-US25-2
DescriptionHuman cytomegalovirus miR-US25-2 stem-loop
Stem-loop
      uua    --u  g             -    ucuuc        g 
5' cgg   gcgg   cu uucagguggauga gggc     acggucgg c
   |||   ||||   || ||||||||||||| ||||     ||||||||  
3' gcc   cgcc   ga agguucaccuacu uccg     ugucggcu a
      ugg    cuc  g             g    -----        c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 215447-215536 [-]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US25-2
hcmv-mir-US33HEHCMVCG: 220470-220539 [-]
hcmv-mir-US29HEHCMVCG: 220469-220540 [+]
hcmv-mir-US25-2HEHCMVCG: 215447-215536 [-]
hcmv-mir-US25-1HEHCMVCG: 215245-215314 [-]
hcmv-mir-US22HEHCMVCG: 209922-209993 [+]
Database links

Mature sequence hcmv-miR-US25-2-5p

Accession MIMAT0001582
Previous IDshcv-miR-US25-2-5p
Sequence

6 - 

agcggucuguucagguggauga

 - 27

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

Mature sequence hcmv-miR-US25-2-3p

Accession MIMAT0001583
Previous IDshcv-miR-US25-2-3p
Sequence

64 - 

auccacuuggagagcucccgcggu

 - 87

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).