Stem-loop sequence hcmv-mir-US25-1

AccessionMI0001684 (change log)
Previous IDshcv-miR-US25-1
DescriptionHuman cytomegalovirus miR-US25-1 stem-loop
Stem-loop
   u u      - uc    gc        ccg  u  u 
5'  g gaaccg c  agug  ucggaccg   gc gu u
    | |||||| |  ||||  ||||||||   || ||  
3'  c cuuggc g  ucgc  agccuggc   cg cg c
   a u      u ga    -a        -ca  -  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 215245-215314 [-]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US25-1
hcmv-mir-US33HEHCMVCG: 220470-220539 [-]
hcmv-mir-US29HEHCMVCG: 220469-220540 [+]
hcmv-mir-US25-2HEHCMVCG: 215447-215536 [-]
hcmv-mir-US25-1HEHCMVCG: 215245-215314 [-]
hcmv-mir-US22HEHCMVCG: 209922-209993 [+]
Database links

Mature sequence hcmv-miR-US25-1-5p

Accession MIMAT0001581
Previous IDshcv-miR-US25-1;hcmv-miR-US25-1
Sequence

5 - 

aaccgcucaguggcucggacc

 - 25

Get sequence
Evidence experimental; cloned [1-3], Illumina [4-5]

Mature sequence hcmv-miR-US25-1-3p

Accession MIMAT0004755
Previous IDshcmv-miR-US25-1*
Sequence

48 - 

uccgaacgcuaggucgguucu

 - 68

Get sequence
Evidence experimental; cloned [3], Illumina [4-5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:16207254 "Human cytomegalovirus expresses novel microRNAs during productive viral infection" Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F Cell Microbiol. 7:1684-1695(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
5
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).