|
miRBase |
|
Stem-loop sequence hcmv-mir-UL148D |
|
| Accession | MI0001681 |
| Previous IDs | hcv-miR-UL148D-1;hcmv-mir-UL148D-1 |
| Description | Human cytomegalovirus miR-UL148D stem-loop |
| Stem-loop |
a a uu c a -g gga gc ggugagg gggg ggac acgu uugc u || ||||||| |||| |||| |||| |||| cg ccacuuc cccc ccug ugca agcg u c - uu u c ag gug |
Mature sequence hcmv-miR-UL148D |
|
| Accession | MIMAT0001578 |
| Previous IDs | hcv-miR-UL148D-1;hcmv-miR-UL148D-1 |
| Sequence |
50 - ucguccuccccuucuucaccg - 70 |
| Evidence | experimental; cloned [1-2] |
References |
|
| 1 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|