Stem-loop sequence hcmv-mir-UL148D

AccessionMI0001681 (change log)
Previous IDshcv-miR-UL148D-1;hcmv-mir-UL148D-1
DescriptionHuman cytomegalovirus miR-UL148D stem-loop
Stem-loop
   a  a       uu    c    a    -g    gga 
5'  gc ggugagg  gggg ggac acgu  uugc   u
    || |||||||  |||| |||| ||||  ||||    
3'  cg ccacuuc  cccc ccug ugca  agcg   u
   c  -       uu    u    c    ag    gug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hcmv-miR-UL148D

Accession MIMAT0001578
Previous IDshcv-miR-UL148D-1;hcmv-miR-UL148D-1
Sequence

50 - 

ucguccuccccuucuucaccg

 - 70

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).