Stem-loop sequence hcmv-mir-UL112

AccessionMI0001680 (change log)
Previous IDshcv-miR-UL112-1;hcmv-mir-UL112-1
DescriptionHuman cytomegalovirus miR-UL112 stem-loop
Stem-loop
           cc     a   g      c  c  cu 
5' gacagccu  ggauc cau guuacu ag gu  g
   ||||||||  ||||| ||| |||||| || ||   
3' cugucgga  ccuag gug caguga uc cg  c
           --     a   g      a  -  ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 163187-163253 [+]
intergenic
Database links

Mature sequence hcmv-miR-UL112-5p

Accession MIMAT0026552
Sequence

6 - 

ccuccggaucacaugguuacuca

 - 28

Get sequence
Evidence experimental; Illumina [3]

Mature sequence hcmv-miR-UL112-3p

Accession MIMAT0001577
Previous IDshcv-miR-UL112-1;hcmv-miR-UL112-1
Sequence

43 - 

aagugacggugagauccaggcu

 - 64

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).