Stem-loop sequence hcmv-mir-UL36

AccessionMI0001679 (change log)
Previous IDshcv-miR-UL36-1;hcmv-mir-UL36-1
DescriptionHuman cytomegalovirus miR-UL36 stem-loop
Stem-loop
         -                     gg    uc  u 
5' ccacgu cguugaagacaccuggaaaga  acgu  gc c
   |||||| |||||||||||||||||||||  ||||  ||  
3' ggugcg gcaacuuuuguggaccuuucu  ugca  cg g
         u                     --    --  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 49493-49567 [-]
intergenic
Database links

Mature sequence hcmv-miR-UL36-5p

Accession MIMAT0001576
Previous IDshcv-miR-UL36-1;hcmv-miR-UL36-1;hcmv-miR-UL36
Sequence

6 - 

ucguugaagacaccuggaaaga

 - 27

Get sequence
Evidence experimental; cloned [1,3], Northern [2], Illumina [4-5]

Mature sequence hcmv-miR-UL36-3p

Accession MIMAT0004754
Previous IDshcmv-miR-UL36*
Sequence

50 - 

uuuccagguguuuucaacgugc

 - 71

Get sequence
Evidence experimental; cloned [3], Illumina [4-5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:16140786 "Identification and characterization of human cytomegalovirus-encoded microRNAs" Grey F, Antoniewicz A, Allen E, Saugstad J, McShea A, Carrington JC, Nelson J J Virol. 79:12095-12099(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
5
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).