Stem-loop sequence mghv-mir-M1-9

Accession MI0001677
Previous IDs mhv-miR-M1-9
Description Mouse gammaherpesvirus 68 miR-M1-9 stem-loop
Stem-loop
--u     u  c         u   u  aua 
   gaggu cc ggcaaaugu gga ag   g
   ||||| || ||||||||| ||| ||    
   uucca gg ccguuuaca ucu uc   g
uuu     -  u         c   -  aau 
Get sequence
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 5525-5584 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-9
mghv-mir-M1-1 U97553: 196-260 [+]
mghv-mir-M1-10 U97553: 262-322 [+]
mghv-mir-M1-2 U97553: 562-627 [+]
mghv-mir-M1-3 U97553: 638-698 [+]
mghv-mir-M1-11 U97553: 759-811 [+]
mghv-mir-M1-4 U97553: 956-1049 [+]
mghv-mir-M1-5 U97553: 1255-1314 [+]
mghv-mir-M1-6 U97553: 1319-1381 [+]
mghv-mir-M1-7 U97553: 1660-1719 [+]
mghv-mir-M1-12 U97553: 1720-1789 [+]
mghv-mir-M1-8 U97553: 3806-3876 [+]
mghv-mir-M1-14 U97553: 5102-5161 [+]
mghv-mir-M1-15 U97553: 5461-5514 [+]
mghv-mir-M1-9 U97553: 5525-5584 [+]

Mature sequence mghv-miR-M1-9

Accession MIMAT0001573
Previous IDs mhv-miR-M1-9
Sequence

39 - 

ucacauuugccuggaccuuuuu

 - 60

Get sequence
Evidence experimental; cloned [1-3], 454 [4], Solexa [5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).