Stem-loop sequence mghv-mir-M1-8

AccessionMI0001676 (change log)
Previous IDsmhv-miR-M1-8
DescriptionMouse gammaherpesvirus 68 miR-M1-8 stem-loop
Stem-loop
   uuuaccagc       g      u     gga    a 
5'          acucacu gggguu gguca   gauc a
            ||||||| |||||| |||||   |||| g
3'          ugaguga ucccaa ccagu   cuag u
   --uucuuuu       a      -     ---    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 3806-3876 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-8
mghv-mir-M1-1U97553: 196-260 [+]
mghv-mir-M1-10U97553: 262-322 [+]
mghv-mir-M1-2U97553: 562-627 [+]
mghv-mir-M1-3U97553: 638-698 [+]
mghv-mir-M1-11U97553: 759-811 [+]
mghv-mir-M1-4U97553: 956-1049 [+]
mghv-mir-M1-5U97553: 1255-1314 [+]
mghv-mir-M1-6U97553: 1319-1381 [+]
mghv-mir-M1-7U97553: 1660-1719 [+]
mghv-mir-M1-12U97553: 1720-1789 [+]
mghv-mir-M1-13U97553: 3749-3808 [+]
mghv-mir-M1-8U97553: 3806-3876 [+]
mghv-mir-M1-14U97553: 5102-5161 [+]
mghv-mir-M1-15U97553: 5461-5514 [+]
mghv-mir-M1-9U97553: 5525-5584 [+]
Database links

Mature sequence mghv-miR-M1-8-5p

Accession MIMAT0001572
Previous IDsmhv-miR-M1-8;mghv-miR-M1-8
Sequence

7 - 

agcacucacuggggguuugguc

 - 28

Get sequence
Evidence experimental; cloned [1-3], 454 [4], Illumina [5]

Mature sequence mghv-miR-M1-8-3p

Accession MIMAT0017191
Previous IDsmghv-mir-M1-8*;mghv-miR-M1-8*
Sequence

46 - 

ugaccaacccuaagugaguuuu

 - 67

Get sequence
Evidence experimental; 454 [4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).