Stem-loop sequence mghv-mir-M1-7

Accession MI0001675
Previous IDs mhv-miR-M1-7
Description Mouse gammaherpesvirus 68 miR-M1-7 stem-loop
Stem-loop 
---        ag        acc      g u 
   aaaggugg  gugcggua   uccuaa a u
   ||||||||  ||||||||   |||||| |  
   uuuccacc  cgcgcuau   aggguu u a
uua        --        ---      g c
Get sequence
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 1660-1719 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-7
mghv-mir-M1-1 U97553: 196-260 [+]
mghv-mir-M1-10 U97553: 262-322 [+]
mghv-mir-M1-2 U97553: 562-627 [+]
mghv-mir-M1-3 U97553: 638-698 [+]
mghv-mir-M1-11 U97553: 759-811 [+]
mghv-mir-M1-4 U97553: 956-1049 [+]
mghv-mir-M1-5 U97553: 1255-1314 [+]
mghv-mir-M1-6 U97553: 1319-1381 [+]
mghv-mir-M1-7 U97553: 1660-1719 [+]
mghv-mir-M1-12 U97553: 1720-1789 [+]
mghv-mir-M1-8 U97553: 3806-3876 [+]
mghv-mir-M1-14 U97553: 5102-5161 [+]
mghv-mir-M1-15 U97553: 5461-5514 [+]
mghv-mir-M1-9 U97553: 5525-5584 [+]

Mature sequence mghv-miR-M1-7-5p

Accession MIMAT0001570
Previous IDs mhv-miR-M1-7-5p
Sequence

1 -  

aaagguggaggugcgguaaccu

 - 22

Get sequence
Evidence experimental; cloned [1-3], 454 [4], Solexa [5]

Mature sequence mghv-miR-M1-7-3p

Accession MIMAT0001571
Previous IDs mhv-miR-M1-7-3p
Sequence

40 -  

gauaucgcgcccaccuuuauu

 - 60

Get sequence
Evidence experimental; cloned [1-3], 454 [4], Solexa [5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:19948768 "Mature and functional viral miRNAs transcribed from novel RNA polymerase III promoters" Diebel KW, Smith AL, van Dyk LF RNA. 16:170-185(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).