Stem-loop sequence mghv-mir-M1-4

AccessionMI0001672 (change log)
Previous IDsmhv-miR-M1-4
DescriptionMouse gammaherpesvirus 68 miR-M1-4 stem-loop
Stem-loop
   c   cc     --------  uc     --           uc   accuc 
5'  gag  cugac        ca  gagga  gcacguguuau  uag     u
    |||  |||||        ||  |||||  |||||||||||  |||     c
3'  cuu  gacug        gu  cuccu  cguguacgaua  auc     u
   -   au     aacccuuu  uu     gc           ga   gaccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 956-1049 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-4
mghv-mir-M1-1U97553: 196-260 [+]
mghv-mir-M1-10U97553: 262-322 [+]
mghv-mir-M1-2U97553: 562-627 [+]
mghv-mir-M1-3U97553: 638-698 [+]
mghv-mir-M1-11U97553: 759-811 [+]
mghv-mir-M1-4U97553: 956-1049 [+]
mghv-mir-M1-5U97553: 1255-1314 [+]
mghv-mir-M1-6U97553: 1319-1381 [+]
mghv-mir-M1-7U97553: 1660-1719 [+]
mghv-mir-M1-12U97553: 1720-1789 [+]
mghv-mir-M1-13U97553: 3749-3808 [+]
mghv-mir-M1-8U97553: 3806-3876 [+]
mghv-mir-M1-14U97553: 5102-5161 [+]
mghv-mir-M1-15U97553: 5461-5514 [+]
mghv-mir-M1-9U97553: 5525-5584 [+]
Database links

Mature sequence mghv-miR-M1-4-5p

Accession MIMAT0001567
Previous IDsmhv-miR-M1-4;mghv-miR-M1-4
Sequence

14 - 

ucgaggagcacguguuauucua

 - 35

Get sequence
Evidence experimental; cloned [1-3], 454 [4], Illumina [5]

Mature sequence mghv-miR-M1-4-3p

Accession MIMAT0017188
Previous IDsmghv-mir-M1-4*;mghv-miR-M1-4*
Sequence

53 - 

agauagcaugugccguccucuuu

 - 75

Get sequence
Evidence experimental; 454 [4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).