Stem-loop sequence mghv-mir-M1-3

AccessionMI0001671 (change log)
Previous IDsmhv-miR-M1-3
DescriptionMouse gammaherpesvirus 68 miR-M1-3 stem-loop
Stem-loop
   gaagu    -   cu         g     g 
5'      agcg aac  cugcucacu cccgg c
        |||| |||  ||||||||| ||||| c
3'      ucgc uug  gacgagugg gggcc c
   ---uu    g   ag         a     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 638-698 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-3
mghv-mir-M1-1U97553: 196-260 [+]
mghv-mir-M1-10U97553: 262-322 [+]
mghv-mir-M1-2U97553: 562-627 [+]
mghv-mir-M1-3U97553: 638-698 [+]
mghv-mir-M1-11U97553: 759-811 [+]
mghv-mir-M1-4U97553: 956-1049 [+]
mghv-mir-M1-5U97553: 1255-1314 [+]
mghv-mir-M1-6U97553: 1319-1381 [+]
mghv-mir-M1-7U97553: 1660-1719 [+]
mghv-mir-M1-12U97553: 1720-1789 [+]
mghv-mir-M1-13U97553: 3749-3808 [+]
mghv-mir-M1-8U97553: 3806-3876 [+]
mghv-mir-M1-14U97553: 5102-5161 [+]
mghv-mir-M1-15U97553: 5461-5514 [+]
mghv-mir-M1-9U97553: 5525-5584 [+]
Database links

Mature sequence mghv-miR-M1-3-5p

Accession MIMAT0017187
Previous IDsmghv-mir-M1-3*;mghv-miR-M1-3*
Sequence

6 - 

agcgaaccucugcucacugccc

 - 27

Get sequence
Evidence experimental; 454 [3]

Mature sequence mghv-miR-M1-3-3p

Accession MIMAT0001566
Previous IDsmhv-miR-M1-3;mghv-miR-M1-3
Sequence

39 - 

gaggugagcaggaguugcgcuu

 - 60

Get sequence
Evidence experimental; cloned [1-2], 454 [3], Illumina [4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).