Stem-loop sequence rno-mir-365

AccessionMI0001656 (change log)
DescriptionRattus norvegicus miR-365 stem-loop
Gene family MIPF0000061; mir-365
Literature search

13 open access papers mention rno-mir-365
(248 sentences)

Stem-loop
   aca       a        ac   c       -----    u   u 
5'    gcaagaa aaugaggg  uuu aggggca     gcug guu c
      ||||||| ||||||||  ||| |||||||     |||| |||  
3'    cguucuu uuauuccu  aaa uccccgu     ugac cag c
   --a       g        aa   -       aauac    u   u 
Get sequence
Deep sequencing
33038 reads, 11.8 reads per million, 483 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321).

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 67079796-67079881 [+]
intergenic
Database links

Mature sequence rno-miR-365-5p

Accession MIMAT0017184
Previous IDsrno-miR-365*
Sequence

15 - 

gagggacuuucaggggc

 - 31

Get sequence
Deep sequencing887 reads, 267 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-365-3p

Accession MIMAT0001549
Previous IDsrno-miR-365
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Deep sequencing32148 reads, 481 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).