Stem-loop sequence cfa-mir-450a

AccessionMI0001655 (change log)
Previous IDscfa-mir-450
DescriptionCanis familiaris miR-450a stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   --gaaa     u       uuu     u              cag 
5'       gaugc gaacugu   ugcga guguuccuaauaug   u
         ||||| |||||||   ||||| ||||||||||||||   a
3'       cuaug uuuggua   acguu uacgaggguuauac   u
   auauaa     u       cgu     u              aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MI0000313).

Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 105177439-105177529 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-450a
cfa-mir-424chrX: 105183437-105183493 [-]
cfa-mir-503chrX: 105183139-105183201 [-]
cfa-mir-542chrX: 105178359-105178417 [-]
cfa-mir-450achrX: 105177439-105177529 [-]
cfa-mir-450bchrX: 105177287-105177344 [-]
Database links

Mature sequence cfa-miR-450a

Accession MIMAT0001548
Previous IDscfa-miR-450
Sequence

17 - 

uuuuugcgauguguuccuaaua

 - 38

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).