Stem-loop sequence rno-mir-450a

AccessionMI0001654 (change log)
Previous IDsrno-mir-450
DescriptionRattus norvegicus miR-450a stem-loop
Gene family MIPF0000128; mir-450
Literature search

4 open access papers mention rno-mir-450a
(15 sentences)

Stem-loop
   --gaga    cg         u     u              ugc 
5'       gaug  gagcuguuu ugcga guguuccuaaugug   u
         ||||  ||||||||| ||||| ||||||||||||||   a
3'       cuac  uuugauaaa acguu uacaaggguuauau   c
   acacag    au         u     u              uaa 
Get sequence
Deep sequencing
538011 reads, 363 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MI0000313).

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158153377-158153467 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-450a
rno-mir-322-1chrX: 158148161-158148255 [+]
rno-mir-503-1chrX: 158148476-158148546 [+]
rno-mir-351-1chrX: 158149206-158149286 [+]
rno-mir-542-1chrX: 158152146-158152224 [+]
rno-mir-450b-1chrX: 158153254-158153322 [+]
rno-mir-450achrX: 158153377-158153467 [+]
rno-mir-542-2chrX: 158158885-158158963 [+]
Database links

Mature sequence rno-miR-450a-5p

Accession MIMAT0001547
Previous IDsrno-miR-450;rno-miR-450a
Sequence

18 - 

uuuugcgauguguuccuaaugu

 - 39

Get sequence
Deep sequencing537325 reads, 494 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-450a-3p

Accession MIMAT0017183
Previous IDsrno-miR-450a*
Sequence

52 - 

uauugggaacauuuugcauaa

 - 72

Get sequence
Deep sequencing685 reads, 172 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).